500Lagu Pop Terbaru 3.1 download APK per Android. Top 500 Indonesian pop songs latest and best selection of 2018
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNFNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNEmNNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNNEmNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
Beritadan foto terbaru Chord Kunci Gitar Bidadari Kesleo - Chord Kunci Gitar Bidadari Kesleo Via Vallen
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCAmCCCCCCCCCFmCCCCCmCCCDCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCCmCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCFCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCFCCCCGCCCCCCCACCCCCCCFCCCCCCCCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
Selainlagu Kanggo Kowe ada juga lagu lainnya dari Via Vallen yaitu Bidadari Kesleo, Kuburan Mantan, Emong, dan lainnya. Download lagu Via Vallen Kanggo Kowe koplo mp3 dan chord gitar tidak kami sediakan di blog Lirik Lagu Via Vallen, kami hanya menyediakan Lirik Lagu Via Vallen - Kanggo Kowe dan Artinya.
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCDCCCCCCCCmCCCCCCGCCDCGCCCAmCCCCCFmCDCCCCCCCCCCCCCCCGCCCCCCCACCCAmCCCDCCCCCACCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCDCCCCCCCCCCCCCCCCCCCCCCCGCCCCCCCCCCCACCCDCCCCCCCCCCCCCCCGmCCCCCCCACCCCCCCDCCCCCACCCCCCCAmCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCAmCFmCCCCCDCCCCCACCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCFCCCCACCCDCCCCCCACCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCCCmCCCCCGCCCCCCDCCCCACCCDCCCCCACCCCCFCCCGmCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGmCCCCCCCACCCCCCCDCCCCCACCCCCCCCCGmCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCAmCCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCDCCCCCCCCFCCCCCCCGCCCCCFCCCCACCCCDCCCCACCCmCCCACCCGCCCCCFmCACCCCCCCDCCCCCCCCCCmCCCCCGCCCCCDCCCFCACCCDCACDCACCmCACCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGmCCCCCCCACCCCCCCDCCCCCACCCCCCCCCGmCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
berikutini adalah lagu Via Vallen Terbaru yang berjudul 'Bidadari Kesleo' karaoke instrumental tanpa vokalFanPageFacebook
Lirik Lagu Bidadari Keseleo - Via Vallen, Lengkap dengan Chord Kunci Gitar Intro D Bm G A D Bmuntumu ono kawate G Aono lomboke ono kangkunge D Bmyen mrebges ketok aslimu G Aketok wagumu ketok mrongosmu Dbidadari kesleo Dmekso - mekso banget Bmnganggo kawat abang ijo Bmpupure mendok mirok Gkaton kandel separo Gdowo untune koyo sungai Abengawan solo - solo Dbidadari kesleo Dngempet - ngempet banget Bmdadi pingin duwe bojo Bmopo mungkin samar Gyen ora keduman jodoh Glan opo mungkin amung arepApengen mlekoto koto D Bmsing tenang ben iso mikir G Ara usah sumelang ojo kuwatir D Bmsing penting lurus mlakumu G Anganteng atimu nganteng sifatmu Reff Daku ra peduliDsenajan elek rupakuBmakeh uwong ngomongBmuntuku rodo metuGora bakal taj gubrisG Ajare mbokdeku aku manis Ayen jarene bapak aku iki rodo mbois Dtimbangane nyacatD Bmopo wos ayu rupamu untuku tak kawatBmra jalok duek embokmuGsing penting ra bejatGkoyo kelakuanmuAwis kono ndang minggatAsenep ku ndelok rupamu D Bm untumu ono kawate G Aono lomboke ono kangkunge D Bmyen mrebges ketok aslimu G Aketok wagumu ketok mrongosmu Dbidadari kesleo Dmekso - mekso banget Bmnganggo kawat abang ijo Bmpupure mendok mirok Gkaton kandel separo Gdowo untune koyo sungaiAbengawan solo - solo D bidadari kesleo Dngempet - ngempet bangetAdadi pingin duwe bojo Dopo mungkin samar Bmyen ora keduman jodoh Bmlan opo mungkin amung arep Gpengen mlekoto koto D Bmsing tenang ben iso mikir G Ara usah sumelang ojo kuwatir D Bmsing penting lurus mlakumu G Anganteng atimu nganteng sifatmu
ViaVallen - Bidadari Keseleo - Hallo sahabat √ Lirik Lagu dan Kunci Gitar Chord, Pada Artikel yang anda baca kali ini dengan judul Via Vallen - Bidadari Keseleo, kami telah mempersiapkan artikel ini dengan baik untuk anda baca dan ambil Lirik dan Kunci Lagu didalamnya. mudah-mudahan isi postingan Artikel Via Vallen, yang kami tulis ini dapat anda pahami. baiklah, selamat membaca.
© Chordvisa Powered by Blogger
Bidadarikesleo mekso mekso banget nganggo kawat abang ijo Pupure medok mirok katon kandel separo Dowo untune koyo sungai bengawan solo solo Bidadari kesleo ngempet-ngempet banget dadi pengen nduwe bojo Opo mungkin samar yen ora keduman jodoh Lan opo mungkin amung ngarep pengen mlekoto Bidadari kesleo mekso mekso banget nganggo kawat abang ijo
NnlV. fgim1ij7le.pages.dev/1fgim1ij7le.pages.dev/544fgim1ij7le.pages.dev/421fgim1ij7le.pages.dev/279fgim1ij7le.pages.dev/191fgim1ij7le.pages.dev/256fgim1ij7le.pages.dev/162fgim1ij7le.pages.dev/420
chord via vallen bidadari kesleo